LOC561288

Ensembl ID:
ENSDARG00000032157
Human Orthologue:
GRK6
Human Description:
G protein-coupled receptor kinase 6 [Source:HGNC Symbol;Acc:4545]
Mouse Orthologue:
Grk6
Mouse Description:
G protein-coupled receptor kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1347078]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13892 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027459 Nonsense 117 575 5 16
Genomic Location:
Chromosome 21 (position 36022732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAAGCATGGTTTCACATACCAGTTCTTCTGTTTGCAGTCAGWAGACTA[C/A]ATCCCTGAGGTAACAGARGAGATGGTGACTAAGTGTGCAGAMYGCTTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ewcuhrtk