ppm1aa

Ensembl ID:
ENSDARG00000032155
ZFIN ID:
ZDB-GENE-991102-15
Description:
protein phosphatase 1A [Source:RefSeq peptide;Acc:NP_571504]
Human Orthologue:
PPM1A
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1A [Source:HGNC Symbol;Acc:9275]
Mouse Orthologue:
Ppm1a
Mouse Description:
protein phosphatase 1A, magnesium dependent, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:99878]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35528 Nonsense Mutation detected in F1 DNA During 2017
sa17877 Essential Splice Site Available for shipment Available now
sa31939 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040451 Nonsense 35 384 2 6
ENSDART00000076527 Nonsense 35 384 2 6
ENSDART00000126658 Nonsense 35 390 1 5
ENSDART00000127843   None 218 None 5
Genomic Location (Zv9):
Chromosome 13 (position 31773373)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31419321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAACAGTCTTCGCTACGGCCTGAGCAGCATGCAGGGCTGGCGTGTT[G/T]AGATGGAAGATGCGCACACCGCTGTCATCGGCCTGCCCAACAGTCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040451 Essential Splice Site 362 384 4 6
ENSDART00000076527 Essential Splice Site 362 384 4 6
ENSDART00000126658 Essential Splice Site 362 390 3 5
ENSDART00000127843 Essential Splice Site 190 218 3 5
Genomic Location (Zv9):
Chromosome 13 (position 31775877)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31421825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAWCTGAGAGCATCCCAAACCTACCCCCTGGAGGAGAACTGGCCAGCAA[G/T]TGAGTACCATACTYACCCAAACCCYGGCGATCTGTCCATGCAAGACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040451 Essential Splice Site 362 384 4 6
ENSDART00000076527 Essential Splice Site 362 384 4 6
ENSDART00000126658 Essential Splice Site 362 390 3 5
ENSDART00000127843 Essential Splice Site 190 218 3 5
Genomic Location (Zv9):
Chromosome 13 (position 31775878)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31421826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGAGAGCATCCCAAACCTACCCCCTGGAGGAGAACTGGCCAGCAAG[T/C]GAGTACCATACTTACCCAAACCCCGGCGATCTGTCCATGCAAGACTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link