drd3

Ensembl ID:
ENSDARG00000032131
ZFIN ID:
ZDB-GENE-021119-1
Description:
D(3) dopamine receptor [Source:RefSeq peptide;Acc:NP_898890]
Human Orthologue:
DRD3
Human Description:
dopamine receptor D3 [Source:HGNC Symbol;Acc:3024]
Mouse Orthologue:
Drd3
Mouse Description:
dopamine receptor D3 Gene [Source:MGI Symbol;Acc:MGI:94925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15862 Essential Splice Site Available for shipment Available now
sa6765 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039851 Essential Splice Site 268 454 6 8
ENSDART00000129675 Essential Splice Site 280 466 5 7
ENSDART00000130568 Essential Splice Site 286 472 6 8
Genomic Location (Zv9):
Chromosome 24 (position 21593421)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20840550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACAAAGAGAAAAGAGACCTTTCCCCCATCAGGATCAATGTGATAACT[G/A]TGCGTATGCCATTGGGCGTCTGCATGCGTGTATAGAAATGCRTGTGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039851 Nonsense 396 454 8 8
ENSDART00000129675 Nonsense 408 466 7 7
ENSDART00000130568 Nonsense 414 472 8 8
Genomic Location (Zv9):
Chromosome 24 (position 21613980)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20861109
KASP Assay ID:
554-4290.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCMTGTCTATTTGTGTGTGTTNNTGTTTTGCAGGTGTTTTTCTTATTTGCTG[G/A]CTGCCTTTCTTTGTGACYCACATCCTCAACACTCATTGCAGAGCTTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link