
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
drd3
- Ensembl ID:
- ENSDARG00000032131
- ZFIN ID:
- ZDB-GENE-021119-1
- Description:
- D(3) dopamine receptor [Source:RefSeq peptide;Acc:NP_898890]
- Human Orthologue:
- DRD3
- Human Description:
- dopamine receptor D3 [Source:HGNC Symbol;Acc:3024]
- Mouse Orthologue:
- Drd3
- Mouse Description:
- dopamine receptor D3 Gene [Source:MGI Symbol;Acc:MGI:94925]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15862 | Essential Splice Site | Available for shipment | Available now |
sa6765 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15862
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039851 | Essential Splice Site | 268 | 454 | 6 | 8 |
ENSDART00000129675 | Essential Splice Site | 280 | 466 | 5 | 7 |
ENSDART00000130568 | Essential Splice Site | 286 | 472 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 24 (position 21593421)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 20840550 GRCz11 24 20984969 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACACAAAGAGAAAAGAGACCTTTCCCCCATCAGGATCAATGTGATAACT[G/A]TGCGTATGCCATTGGGCGTCTGCATGCGTGTATAGAAATGCRTGTGACTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6765
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039851 | Nonsense | 396 | 454 | 8 | 8 |
ENSDART00000129675 | Nonsense | 408 | 466 | 7 | 7 |
ENSDART00000130568 | Nonsense | 414 | 472 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 24 (position 21613980)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 20861109 GRCz11 24 21005528 - KASP Assay ID:
- 554-4290.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCMTGTCTATTTGTGTGTGTTNNTGTTTTGCAGGTGTTTTTCTTATTTGCTG[G/A]CTGCCTTTCTTTGTGACYCACATCCTCAACACTCATTGCAGAGCTTGTCA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: