gtf2f1

Ensembl ID:
ENSDARG00000032129
ZFIN ID:
ZDB-GENE-030131-4557
Description:
general transcription factor IIF subunit 1 [Source:RefSeq peptide;Acc:NP_956023]
Human Orthologue:
GTF2F1
Human Description:
general transcription factor IIF, polypeptide 1, 74kDa [Source:HGNC Symbol;Acc:4652]
Mouse Orthologue:
Gtf2f1
Mouse Description:
general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26104 Nonsense Mutation detected in F1 DNA During 2017
sa40105 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026090 Nonsense 146 536 6 14
ENSDART00000047660 Nonsense 146 536 7 15
ENSDART00000111878 Nonsense 146 443 7 13
ENSDART00000122357 Nonsense 146 536 5 14
Genomic Location (Zv9):
Chromosome 3 (position 34020392)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33805588
KASP Assay ID:
2259-3721.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACACAGAGTGCCGATGGTGCTTTTGAGGCATTTCCCGTGCACGCCTG[G/A]TATAACTTCACACCACAGGCCAAACACCGCACGCTCACAGCTGAGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026090 Essential Splice Site 378 536 12 14
ENSDART00000047660 Essential Splice Site 378 536 13 15
ENSDART00000111878 Essential Splice Site 285 443 11 13
ENSDART00000122357 Essential Splice Site 378 536 11 14
Genomic Location (Zv9):
Chromosome 3 (position 34016197)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 33801393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATGTGAATATGGTACAGTGCTTTTTTCTTGTTGTCTCTGTCACA[G/A]AAGAAGCGCACACCTCCTAAGCGAGGAGGTGGCCGTGGCTCAGCAGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link