cnot7

Ensembl ID:
ENSDARG00000032116
ZFIN ID:
ZDB-GENE-061013-29
Description:
CCR4-NOT transcription complex subunit 7 [Source:UniProtKB/Swiss-Prot;Acc:Q08BM8]
Human Orthologue:
CNOT7
Human Description:
CCR4-NOT transcription complex, subunit 7 [Source:HGNC Symbol;Acc:14101]
Mouse Orthologue:
Cnot7
Mouse Description:
CCR4-NOT transcription complex, subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1298230]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092953 Nonsense 260 286 7 7
ENSDART00000136009 None None 224 7 7

The following transcripts of ENSDARG00000032116 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 31293271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRTTTTTTGAAGATCACATTGATGATGCAAAGTATTGTGGTCACTTATA[C/A]GGACTGGGTTCAGGCTCATCCTATGTCCAGAACGGTACYGGAAATGCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x47jyvs7