mapk6

Ensembl ID:
ENSDARG00000032103
ZFIN ID:
ZDB-GENE-050420-7
Description:
mitogen-activated protein kinase 6 [Source:RefSeq peptide;Acc:NP_001039017]
Human Orthologue:
MAPK6
Human Description:
mitogen-activated protein kinase 6 [Source:HGNC Symbol;Acc:6879]
Mouse Orthologue:
Mapk6
Mouse Description:
mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36706 Nonsense Mutation detected in F1 DNA During 2017
sa36705 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029549 Nonsense 245 729 3 5
Genomic Location (Zv9):
Chromosome 18 (position 37612795)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39194498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATTTGTATGTTCAGGAGCTCACGAGTTGGAACAGATGCAGCTGATTT[T/A]GGAATCCATTCCCGTAGTCCATGAGGAAGACCGACTGGAACTCCAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029549 Nonsense 728 729 5 5
Genomic Location (Zv9):
Chromosome 18 (position 37610562)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39192265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCCCCACAAATCGCCCATAAGACCTACAGCAGCATTTTCAAGCATT[T/A]AAATTGAAAGATTCACCCAATTCAAGCAGAGTCCAGCTTATTTTTTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link