c8g

Ensembl ID:
ENSDARG00000032098
ZFIN ID:
ZDB-GENE-040426-1898
Description:
complement component C8 gamma chain [Source:RefSeq peptide;Acc:NP_957157]
Human Orthologue:
C8G
Human Description:
complement component 8, gamma polypeptide [Source:HGNC Symbol;Acc:1354]
Mouse Orthologue:
C8g
Mouse Description:
complement component 8, gamma polypeptide Gene [Source:MGI Symbol;Acc:MGI:88237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39439 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048823 Nonsense 39 209 1 7
Genomic Location (Zv9):
Chromosome 24 (position 17588536)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16895012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACGAAGAGCGCGATATAAACCAGAACCTCCGAAGCCAAAGAAAACC[G/T]AGACACAGAAAGCTATCGACACATTGGCTCCAGGTCAGAACATCAACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link