dpysl2b

Ensembl ID:
ENSDARG00000032083
ZFIN ID:
ZDB-GENE-031105-1
Description:
dihydropyrimidinase-related protein 2 [Source:RefSeq peptide;Acc:NP_001018353]
Human Orthologue:
DPYSL2
Human Description:
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
Mouse Orthologue:
Dpysl2
Mouse Description:
dihydropyrimidinase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1349763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41632 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064875 Essential Splice Site 372 573 11 14
ENSDART00000130380 Essential Splice Site 448 649 12 15
ENSDART00000146517 Essential Splice Site 335 536 11 14
Genomic Location (Zv9):
Chromosome 10 (position 19013684)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19026030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAATCGAGACCAACTGTCATCTCTCCCTGTGGTCCCTGTCGCCTGTA[G/T]GTAACAGGAAAAATGGATGAAAATCAGTTTGTGGCTGTCACCAGCACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link