acsl3a

Ensembl ID:
ENSDARG00000032079
ZFIN ID:
ZDB-GENE-050420-181
Description:
acyl-CoA synthetase long-chain family member 3 [Source:RefSeq peptide;Acc:NP_001038593]
Human Orthologue:
ACSL3
Human Description:
acyl-CoA synthetase long-chain family member 3 [Source:HGNC Symbol;Acc:3570]
Mouse Orthologue:
Acsl3
Mouse Description:
acyl-CoA synthetase long-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:1921455]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8864 Nonsense Mutation detected in F1 DNA During 2014
sa16715 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 22 713 1 14
Genomic Location:
Chromosome 15 (position 41726681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTGAGTCCAGCYGTGGTGCTTGTTTTCAGGCTGGTGGTTTGGCTGTA[T/G]TCCCTCATCTCCTACCTGCCGTACCTGTTGCTGAGATCACCTGAGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 408 713 8 14
Genomic Location:
Chromosome 15 (position 41783126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAAATGAGTGGATTTCAGAGGACTCTCTTTCTGCTGGCCYACAACTA[C/A]AAGATGGAGCAGCTGGCAATGGGATACAGCACTCCACTGTGTGATAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kxf2g0vu