acsl3a

Ensembl ID:
ENSDARG00000032079
ZFIN ID:
ZDB-GENE-050420-181
Description:
acyl-CoA synthetase long-chain family member 3 [Source:RefSeq peptide;Acc:NP_001038593]
Human Orthologue:
ACSL3
Human Description:
acyl-CoA synthetase long-chain family member 3 [Source:HGNC Symbol;Acc:3570]
Mouse Orthologue:
Acsl3
Mouse Description:
acyl-CoA synthetase long-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:1921455]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8864 Nonsense Mutation detected in F1 DNA During 2016
sa16715 Nonsense Available for shipment Available now
sa32062 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39067 Nonsense Mutation detected in F1 DNA During 2016
sa35990 Nonsense Mutation detected in F1 DNA During 2016
sa42620 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 22 713 1 14
Genomic Location:
Chromosome 15 (position 41726681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTGAGTCCAGCYGTGGTGCTTGTTTTCAGGCTGGTGGTTTGGCTGTA[T/G]TCCCTCATCTCCTACCTGCCGTACCTGTTGCTGAGATCACCTGAGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 408 713 8 14
Genomic Location:
Chromosome 15 (position 41783126)
KASP Assay ID:
2260-8978.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAAATGAGTGGATTTCAGAGGACTCTCTTTCTGCTGGCCYACAACTA[C/A]AAGATGGAGCAGCTGGCAATGGGATACAGCACTCCACTGTGTGATAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Essential Splice Site 424 713 8 14
Genomic Location:
Chromosome 15 (position 41783175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATGGAGCAGCTGGCAATGGGATACAGCACTCCACTGTGTGATAAG[T/C]GTGTCTCTCTTTTACTCACATACACACACACACACACACAAACACAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 443 713 9 14
Genomic Location:
Chromosome 15 (position 41783364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGGAAGGTTCGGGCTCTGCTGGGTGGGCGTCTGCGTGTGTTGTTGT[C/A]AGGCGGAGCTCCTCTGTCTGCGGCGACCCAGCGCTTCATGAACATCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 504 713 10 14
Genomic Location:
Chromosome 15 (position 41785532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGAGTTGGAGCACCGCTGGTCTGCTGTGAACTTCAGCTGAAGGACTG[G/A]ATAGAGGGTGAGTCTCGTAGCATACACACATGCATATATCTGCTCTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042884 Nonsense 694 713 14 14
Genomic Location:
Chromosome 15 (position 41796641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGCCCTGGACCCCAGACACCGGCCTGGTTACAGACTCTTTCAAACTC[A/T]AGAGAAAGGAGCTAAAAACTCACTACCAGAACGACATCGAGAGGATGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link