cdk16

Ensembl ID:
ENSDARG00000032072
ZFIN ID:
ZDB-GENE-030131-2939
Description:
Novel protein similar to vertebrate PCTAIRE protein kinase 1 (PCTK1) [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologue:
CDK16
Human Description:
cyclin-dependent kinase 16 [Source:HGNC Symbol;Acc:8749]
Mouse Orthologue:
Cdk16
Mouse Description:
cyclin-dependent kinase 16 Gene [Source:MGI Symbol;Acc:MGI:97516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14702 Nonsense Available for shipment Available now
sa41122 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093388 Nonsense 126 524 3 16
ENSDART00000132700 Nonsense 71 184 3 6
ENSDART00000137382 Nonsense 126 524 4 17

The following transcripts of ENSDARG00000032072 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8954662)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8371244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCGATCAGGCTTCGGCCAMGTCCTCCGATGAGGTGCACAGTCCCGTC[C/T]GAGTTCGWCTGAGAAACAACCCCGGTCGCAAAATTTCCACWGAGGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093388 Essential Splice Site 201 524 5 16
ENSDART00000132700 Essential Splice Site 146 184 5 6
ENSDART00000137382 Essential Splice Site 201 524 6 17

The following transcripts of ENSDARG00000032072 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8947467)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8364049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGATTTGGGAAGCTGGAGACGTACGTGAAACTGGATAAACTAGGAGAG[G/A]TAACGTTAGCATCTGTTATACACTCCATCACAAAACACCATTCACTCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link