enah

Ensembl ID:
ENSDARG00000032049
ZFIN IDs:
ZDB-GENE-010323-11, ZDB-GENE-050320-93
Description:
protein enabled homolog [Source:RefSeq peptide;Acc:NP_001038493]
Human Orthologue:
ENAH
Human Description:
enabled homolog (Drosophila) [Source:HGNC Symbol;Acc:18271]
Mouse Orthologue:
Enah
Mouse Description:
enabled homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7941 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Essential Splice Site 85 804 None 14
ENSDART00000062893 Essential Splice Site 44 115 None 4
ENSDART00000125209 Essential Splice Site 63 702 None 18
Genomic Location:
Chromosome 20 (position 36559075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAACAACGCCTTCCGAGTAGTGGGCCGTAAAATTCAGGACCACCAGG[T/C]AAGAGAAATGGGAGCTGTGGTCTCGGTGGRTTTGAAAGAAATGCTTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qiw1eo5d