enah

Ensembl ID:
ENSDARG00000032049
ZFIN IDs:
ZDB-GENE-010323-11, ZDB-GENE-050320-93
Description:
protein enabled homolog [Source:RefSeq peptide;Acc:NP_001038493]
Human Orthologue:
ENAH
Human Description:
enabled homolog (Drosophila) [Source:HGNC Symbol;Acc:18271]
Mouse Orthologue:
Enah
Mouse Description:
enabled homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108360]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37114 Nonsense Mutation detected in F1 DNA During 2016
sa7941 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37113 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Nonsense 32 804 2 14
ENSDART00000062893   None 115 2 4
ENSDART00000125209 Nonsense 10 702 2 18
Genomic Location:
Chromosome 20 (position 36559238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGTTTCTCCATCACTCATTTTTCTCTTTTTCTTTCTTTTCAGTGAG[C/T]AGAGTATCTGTCAGGCGAGGGCCGCTGTCATGGTTTATGATGACGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Essential Splice Site 85 804 None 14
ENSDART00000062893 Essential Splice Site 44 115 None 4
ENSDART00000125209 Essential Splice Site 63 702 None 18
Genomic Location:
Chromosome 20 (position 36559075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAACAACGCCTTCCGAGTAGTGGGCCGTAAAATTCAGGACCACCAGG[T/C]AAGAGAAATGGGAGCTGTGGTCTCGGTGGRTTTGAAAGAAATGCTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Nonsense 184 804 5 14
ENSDART00000062893   None 115 None 4
ENSDART00000125209 Nonsense 162 702 5 18
Genomic Location:
Chromosome 20 (position 36474208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAGGCAGCTGCAGGAGCTCCAGCGTCAGAAGGAGAAAGAGCAGGAG[C/T]GACTGGATCGAGAACGACAGGAACGAGAACGTCAGGAGCGAGAGATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link