enah

Ensembl ID:
ENSDARG00000032049
ZFIN IDs:
ZDB-GENE-010323-11, ZDB-GENE-050320-93
Description:
protein enabled homolog [Source:RefSeq peptide;Acc:NP_001038493]
Human Orthologue:
ENAH
Human Description:
enabled homolog (Drosophila) [Source:HGNC Symbol;Acc:18271]
Mouse Orthologue:
Enah
Mouse Description:
enabled homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108360]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37114 Nonsense Available for shipment Available now
sa37113 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Nonsense 32 804 2 14
ENSDART00000062893   None 115 2 4
ENSDART00000125209 Nonsense 10 702 2 18
Genomic Location (Zv9):
Chromosome 20 (position 36559238)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36631751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGTTTCTCCATCACTCATTTTTCTCTTTTTCTTTCTTTTCAGTGAG[C/T]AGAGTATCTGTCAGGCGAGGGCCGCTGTCATGGTTTATGATGACGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026539 Nonsense 184 804 5 14
ENSDART00000062893   None 115 None 4
ENSDART00000125209 Nonsense 162 702 5 18
Genomic Location (Zv9):
Chromosome 20 (position 36474208)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36546721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAGGCAGCTGCAGGAGCTCCAGCGTCAGAAGGAGAAAGAGCAGGAG[C/T]GACTGGATCGAGAACGACAGGAACGAGAACGTCAGGAGCGAGAGATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link