ccdc65

Ensembl ID:
ENSDARG00000032005
ZFIN ID:
ZDB-GENE-030616-358
Description:
Coiled-coil domain-containing protein 65 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHI2]
Human Orthologue:
CCDC65
Human Description:
coiled-coil domain containing 65 [Source:HGNC Symbol;Acc:29937]
Mouse Orthologue:
Ccdc65
Mouse Description:
coiled-coil domain containing 65 Gene [Source:MGI Symbol;Acc:MGI:2146001]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20626 Nonsense Mutation detected in F1 DNA During 2014
sa6066 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043946 Nonsense 27 492 1 8

The following transcripts of ENSDARG00000032005 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 7338822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAAACTGGCCGGGTTGACGGAGGAGGAGAGACTCCTGTACATGCAG[C/T]AAAAGGCTCAAGCGGAGGAGGAAATCGCCAAGAGAAAAGAGGACATGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043946 Nonsense 141 492 3 8

The following transcripts of ENSDARG00000032005 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 7339850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGCAMAACGTGGACTGTCTGTTAGAGATTCATAAGAGTCGACTGGCA[C/T]AACTAGAGTTCAACTTCAAGAGCAGTCTRGWGGAACTTAGCTCAGAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pjq83uc3