ppp2r4

Ensembl ID:
ENSDARG00000031985
ZFIN ID:
ZDB-GENE-040801-11
Description:
serine/threonine-protein phosphatase 2A activator [Source:RefSeq peptide;Acc:NP_001003425]
Human Orthologue:
PPP2R4
Human Description:
protein phosphatase 2A activator, regulatory subunit 4 [Source:HGNC Symbol;Acc:9308]
Mouse Orthologue:
Ppp2r4
Mouse Description:
protein phosphatase 2A, regulatory subunit B (PR 53) Gene [Source:MGI Symbol;Acc:MGI:1346006]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15995 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050041   None 185 None 9
ENSDART00000110372 Missense 153 181 6 7
ENSDART00000135864 Nonsense 153 324 5 10
Genomic Location (Zv9):
Chromosome 5 (position 34425373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32207322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCTGTGTACCTCAAAGAGTCTGTGGGCAACTCCACTAGGATTGACTA[T/A]GGAACAGGTTTGTGAGGAAATTTATCACTGTTNNNNNNNTTTGTTATTTTATTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link