nos2b

Ensembl ID:
ENSDARG00000031976
ZFIN ID:
ZDB-GENE-080916-1
Description:
nitric oxide synthase 2b, inducible [Source:RefSeq peptide;Acc:NP_001106973]
Human Orthologues:
AC015688.1, NOS2
Human Description:
nitric oxide synthase 2, inducible [Source:HGNC Symbol;Acc:7873]
Mouse Orthologue:
Nos2
Mouse Description:
nitric oxide synthase 2, inducible Gene [Source:MGI Symbol;Acc:MGI:97361]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35915 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8873 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35916 Nonsense Mutation detected in F1 DNA During 2017
sa364 Nonsense Available for shipment Available now
sa42569 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048847 Essential Splice Site 19 1077 2 26
Genomic Location (Zv9):
Chromosome 15 (position 29706296)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30444599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGTCACTCACAAGAGCGAACTACTGCAGCAGATGAAACCGGATATGG[T/C]GAGTCAAACTTTAACTAACATGAAATTAAATGTGATTAAGTAAATAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048847 Essential Splice Site 20 1077 3 26
Genomic Location (Zv9):
Chromosome 15 (position 29706365)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30444668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAAATTAAAYKTGATTWAGTAAATAGTAATGTTATGTTGGTTTTCTA[G/A]CAATGGGARARTAAAGTCAAGCAGTGCCCATTTTCTAAGCAATTAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048847 Nonsense 65 1077 4 26
Genomic Location (Zv9):
Chromosome 15 (position 29706698)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30445001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTTTTATTTTAGAGCCATATTTGTTCGTCTAAGATTTGTGAAGGGT[C/A]AATCATGACTCCAAAATCTTTGACGCGCTGTCCCATGACCACTTTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048847 Nonsense 163 1077 6 26
Genomic Location (Zv9):
Chromosome 15 (position 29708420)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30446723
KASP Assay ID:
554-0234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGATTTATATTATGTGGTATTTTTCTGTGCAGTTGTTTGATGCGCGT[A/T]AATGCCAAACTGCTGAGGACATGTTTCAGATGTTATGTGATCATATTCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048847 Essential Splice Site 754 1077 19 26
Genomic Location (Zv9):
Chromosome 15 (position 29722548)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 30460851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCCTATCAACCAGAGCCTTCAGCTGGAATTCCTCAGTGCCCATGCTG[G/A]TACTGAACCATCTAATTACATAATGGATGTCTAACTCATAATAACATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link