kdelc1

Ensembl ID:
ENSDARG00000031971
ZFIN ID:
ZDB-GENE-040426-878
Description:
KDEL motif-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVE6]
Human Orthologue:
KDELC1
Human Description:
KDEL (Lys-Asp-Glu-Leu) containing 1 [Source:HGNC Symbol;Acc:19350]
Mouse Orthologue:
Kdelc1
Mouse Description:
KDEL (Lys-Asp-Glu-Leu) containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919300]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11280 Nonsense Available for shipment Available now
sa3707 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042297 Nonsense 238 500 5 10
ENSDART00000135652 None None 184 None 4
Genomic Location:
Chromosome 9 (position 28439084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGGTCAAGCTTCCAGAYATTGAGTTTTTTGTGAATTTGGGCGACTG[G/A]CCCTWGGAGAAGAGAMRGGCCTCTCAGAATCCCAGCCCGGTGTTTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042297 Nonsense 240 500 5 10
ENSDART00000135652 None None 184 None 4
Genomic Location:
Chromosome 9 (position 28439079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCAAGCTTCCAGAYATTGAGTTTTTTGTGAATTTGGGCGACTGGCCCT[T/A]GGAGAAGAGAMRGGCCTCTCAGAATCCCAGCCCGGTGTTTTCATGGTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ncr6llxg