cpped1

Ensembl ID:
ENSDARG00000031968
ZFIN ID:
ZDB-GENE-041114-118
Description:
Calcineurin-like phosphoesterase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3W0
Human Orthologue:
CPPED1
Human Description:
calcineurin-like phosphoesterase domain containing 1 [Source:HGNC Symbol;Acc:25632]
Mouse Orthologue:
Cpped1
Mouse Description:
calcineurin-like phosphoesterase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15372 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045609 Nonsense 77 309 2 4
Genomic Location:
Chromosome 12 (position 20974290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGGTCCAGCTCACAAAGCAGGCAGTGCAGGCCATCAACAAACTC[C/T]AGCCCAAACCTCGCTTCATAGTGCTGTGTGGAGATCTGGTCCATGCTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pingug8k