si:ch211-117l16.1

Ensembl ID:
ENSDARG00000031956
ZFIN ID:
ZDB-GENE-041210-107
Description:
transmembrane protein 63A [Source:RefSeq peptide;Acc:NP_001082847]
Human Orthologue:
TMEM63A
Human Description:
transmembrane protein 63A [Source:HGNC Symbol;Acc:29118]
Mouse Orthologue:
Tmem63a
Mouse Description:
transmembrane protein 63a Gene [Source:MGI Symbol;Acc:MGI:2384789]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110497 Nonsense 188 802 8 23
ENSDART00000133994 Nonsense 150 764 6 21
Genomic Location (Zv9):
Chromosome 4 (position 5553544)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5671725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTGAACTGTATTTTATGTGATGTATTTTCAGTGATAAGCTGCTTTG[G/A]CTGCACACTGTGTTTGCAGTTCTGTATCTGATGATCACRGTGTTCCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link