erc1b

Ensembl ID:
ENSDARG00000031930
ZFIN ID:
ZDB-GENE-041210-51
Description:
Novel protein similar to vertebrate Rab6-interacting protein 2 (RAB6IP2) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
ERC1
Human Description:
ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
Mouse Orthologue:
Erc1
Mouse Description:
ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20205 Nonsense Mutation detected in F1 DNA During 2015
sa9013 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26218 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa20205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027829 Nonsense 34 606 1 12
ENSDART00000132647   None 243 None 5
ENSDART00000138653   None 144 None 4
Genomic Location:
Chromosome 4 (position 7895608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTTTGCGTCTGGAGGAGAAGGAGGCCACGCTGAATAAAAAGAGCAAG[C/T]AGATTCAAGAGGTGTCGGAGGAGAAAGGCACGCTCAACGGAGAAATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027829 Essential Splice Site 209 606 4 12
ENSDART00000132647   None 243 None 5
ENSDART00000138653   None 144 None 4
Genomic Location:
Chromosome 4 (position 7855381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCAGAAGAAAGAGGAGTGCATCAAACTGGAGAGTCAGCTCAAGAAG[G/A]TGAGCCCAGACACTTGAAGCATCAYRGCTAGCAAATACATCTCTCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027829 Nonsense 330 606 7 12
ENSDART00000132647   None 243 None 5
ENSDART00000138653   None 144 None 4
Genomic Location:
Chromosome 4 (position 7805703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTTTTTTTATTCTTAGGATTCTTTGCGGCTGAAAGACGATCGCATC[G/T]AGGAGCTGGAGGAGGCTTTGCGTGAGAGCGTTCAGATCACTGCTGAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bq0xa6il