hif1an

Ensembl ID:
ENSDARG00000031915
ZFIN ID:
ZDB-GENE-030826-19
Description:
Hypoxia-inducible factor 1-alpha inhibitor [Source:UniProtKB/Swiss-Prot;Acc:P59723]
Human Orthologue:
HIF1AN
Human Description:
hypoxia inducible factor 1, alpha subunit inhibitor [Source:HGNC Symbol;Acc:17113]
Mouse Orthologue:
Hif1an
Mouse Description:
hypoxia-inducible factor 1, alpha subunit inhibitor Gene [Source:MGI Symbol;Acc:MGI:2442345]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38947 Nonsense Mutation detected in F1 DNA During 2017
sa31936 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042049 Nonsense 252 344 5 8

The following transcripts of ENSDARG00000031915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30188435)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29834383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAATCCTGACTATGACAAGTTTCCTAATTTCAAAAATGCTGTTGGGTA[T/A]GAGGCTGTCGTGGGACCCGGAGATGTGCTGTACATCCCCATGTATTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042049 Essential Splice Site 268 344 None 8

The following transcripts of ENSDARG00000031915 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30188386)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29834334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGCTGTCGTGGGACCCGGAGATGTGCTGTACATCCCCATGTATTGG[T/G]AAGTTTGTTTTCAAATACTCTGAGAAAGTGGATCACAATTATTACCTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link