si:ch211-39i19.6

Ensembl ID:
ENSDARG00000031911
ZFIN IDs:
ZDB-GENE-041014-210, ZDB-GENE-041014-210, ZDB-GENE-041014-210, ZDB-GENE-050809-27, ZDB-GENE-050809-27, ZDB-GENE-081031-95
Description:
Novel protein similar to vertebrate tensin family [Source:UniProtKB/TrEMBL;Acc:B8JKC7]
Human Orthologue:
TNS3
Human Description:
tensin 3 [Source:HGNC Symbol;Acc:21616]
Mouse Orthologue:
Tns3
Mouse Description:
tensin 3 Gene [Source:MGI Symbol;Acc:MGI:2443012]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17437 Essential Splice Site Available for shipment Available now
sa7478 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044368 Essential Splice Site 130 1182 5 26
ENSDART00000135390   None 79 None 3
ENSDART00000136567   None 856 None 16
ENSDART00000138361   None 177 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 6667093)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6572167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYATACCATGTTTTGTGTTTCTGACCTGTTTCTTGTTCTYTTGTTTCTCA[G/A]TGAGGAACATGCGTTAGATCTGTATTCCATGAAGAGRTTCTGCAGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044368 Missense 229 1182 8 26
ENSDART00000135390   None 79 None 3
ENSDART00000136567   None 856 None 16
ENSDART00000138361   None 177 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 6675152)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6580226
KASP Assay ID:
554-4136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTCAGTCAGGTTGATGTCGGTCTGATGGACAGAGTGTGTTTTGTTC[T/A]GGATCCTCCTCAGATGATCAAAGGTGATATCATGGTGAGAGACATCTTTY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link