ptbp1b

Ensembl ID:
ENSDARG00000031907
ZFIN ID:
ZDB-GENE-030131-9796
Description:
polypyrimidine tract binding protein-like [Source:RefSeq peptide;Acc:NP_001116126]
Human Orthologue:
PTBP1
Human Description:
polypyrimidine tract binding protein 1 [Source:HGNC Symbol;Acc:9583]
Mouse Orthologue:
Ptbp1
Mouse Description:
polypyrimidine tract binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:97791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21870 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039822 Essential Splice Site 108 564 5 16
ENSDART00000132997   None 35 None 6
ENSDART00000137347 Essential Splice Site 91 92 4 5

The following transcripts of ENSDARG00000031907 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 14568264)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14269560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATTTGGGAAAGTGACCAATCTGCTTATGCTGAAGGGAAAGAACCAG[G/A]TATCTATTCTGCTTTTGATTGTCTTGGCATTAGTGCAGAGTTGGAGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link