lef1

Ensembl ID:
ENSDARG00000031894
ZFIN ID:
ZDB-GENE-990714-26
Description:
lymphoid enhancer-binding factor 1 [Source:RefSeq peptide;Acc:NP_571501]
Human Orthologue:
LEF1
Human Description:
lymphoid enhancer-binding factor 1 [Source:HGNC Symbol;Acc:6551]
Mouse Orthologue:
Lef1
Mouse Description:
lymphoid enhancer binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:96770]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18709 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10902 Essential Splice Site Available for shipment Available now
sa32764 Nonsense Mutation detected in F1 DNA During 2016
sa39684 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
Genomic Location (Zv9):
Chromosome 1 (position 50387446)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49236537
KASP Assay ID:
2259-1084.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACGCTGAAGGAGAGCGCCGCTATCAATCAGATCCTCGGCCGGAGGG[T/C]TCGTATCTTAAAAATCTTCCTTATACGAATGGAGTTAGCACTTTTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
Genomic Location (Zv9):
Chromosome 1 (position 50387446)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49236537
KASP Assay ID:
2259-1084.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACGCTGAAGGAGAGCGCCGCTATCAATCAGATCCTCGGCCGGAGGG[T/C]TCGTATCTTAAAAWTCTTCCTTRTACGAATGGAGTTWGCACTTTTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Nonsense 345 365 9 11
ENSDART00000132405 Nonsense 345 365 9 11
Genomic Location (Zv9):
Chromosome 1 (position 50392549)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49241640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAATATTCATCATTTGTTTTTTTTATAGGGAAAGAAAAAAAAGCGG[A/T]AGAGGGAAAAGATCCAGGAACCTGCTTCAGGTGAGACTCAATAACCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Essential Splice Site 354 365 9 11
ENSDART00000132405 Essential Splice Site 354 365 9 11
Genomic Location (Zv9):
Chromosome 1 (position 50392580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49241671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAAGAAAAAAAAGCGGAAGAGGGAAAAGATCCAGGAACCTGCTTCAG[G/A]TGAGACTCAATAACCTTCTATCCATGCTGATATTTGTGCAGTTTTGTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link