lef1

Ensembl ID:
ENSDARG00000031894
ZFIN ID:
ZDB-GENE-990714-26
Description:
lymphoid enhancer-binding factor 1 [Source:RefSeq peptide;Acc:NP_571501]
Human Orthologue:
LEF1
Human Description:
lymphoid enhancer-binding factor 1 [Source:HGNC Symbol;Acc:6551]
Mouse Orthologue:
Lef1
Mouse Description:
lymphoid enhancer binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:96770]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18709 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10902 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
Genomic Location:
Chromosome 1 (position 50387446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACGCTGAAGGAGAGCGCCGCTATCAATCAGATCCTCGGCCGGAGGG[T/C]TCGTATCTTAAAAATCTTCCTTATACGAATGGAGTTAGCACTTTTATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
ENSDART00000047876 Essential Splice Site 302 365 7 11
ENSDART00000132405 Essential Splice Site 302 365 7 11
Genomic Location:
Chromosome 1 (position 50387446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACGCTGAAGGAGAGCGCCGCTATCAATCAGATCCTCGGCCGGAGGG[T/C]TCGTATCTTAAAAWTCTTCCTTRTACGAATGGAGTTWGCACTTTTATCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h3gequ82