tcp11l1

Ensembl ID:
ENSDARG00000031890
ZFIN ID:
ZDB-GENE-050327-11
Description:
T-complex protein 11-like protein 1 [Source:RefSeq peptide;Acc:NP_001014323]
Human Orthologue:
TCP11L1
Human Description:
t-complex 11 (mouse)-like 1 [Source:HGNC Symbol;Acc:25655]
Mouse Orthologue:
Tcp11l1
Mouse Description:
t-complex 11 like 1 Gene [Source:MGI Symbol;Acc:MGI:2444263]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6800 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045659 Essential Splice Site 134 502 4 10
Genomic Location:
Chromosome 25 (position 15632567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCACCTCAGTATGGCCATGCTATAACACTTGTGGGTGAAATTAAAGAG[G/A]TAAGTACAGAATCYAAGACTACWCGTTATTATTTGGCTTAATAAGCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2llnmg21