ift140

Ensembl ID:
ENSDARG00000031886
ZFIN ID:
ZDB-GENE-040724-165
Description:
Novel protein similar to human KIAA0590 [Source:UniProtKB/TrEMBL;Acc:Q7T007]
Human Orthologue:
IFT140
Human Description:
intraflagellar transport 140 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:29077]
Mouse Orthologue:
Ift140
Mouse Description:
intraflagellar transport 140 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:2146906]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8632 Nonsense Mutation detected in F1 DNA During 2017
sa37952 Nonsense Mutation detected in F1 DNA During 2017
sa39464 Nonsense Mutation detected in F1 DNA During 2017
sa44183 Nonsense Mutation detected in F1 DNA During 2017
sa3253 Nonsense F2 line generated During 2017
sa24548 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 229 1455 5 32
ENSDART00000129889 Nonsense 229 774 6 18
Genomic Location (Zv9):
Chromosome 24 (position 39333868)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37942957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGARTGTGTACAGTGTGGATGAGCAGGTGAAGAGTGTGCCTTTGCTGT[C/A]AGTTGAGAGYGCYGTACATAAGATGTGGTACTCCAAGAGAAGATCYGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 990 1455 25 32
ENSDART00000129889   None 774 None 18
Genomic Location (Zv9):
Chromosome 24 (position 39394365)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38003454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGACATGGAGGCTGCGCTGCATTATTACGACTTAGCTCAGGATTACT[T/A]GTCTCAAGTGCGCGTGCACTGCTACCTGGGAAGCATTCAAAAGGTACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 1038 1455 26 32
ENSDART00000129889   None 774 None 18
Genomic Location (Zv9):
Chromosome 24 (position 39396148)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38005237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGGCAATACGAGGGACAGGATGAAATCAGCCAATCGGTGCACTTCTA[T/A]ACACGCGCACAAGCCTATAATAACGCCATACGACTGTGTAAAGAGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 1135 1455 27 32
ENSDART00000129889   None 774 None 18
Genomic Location (Zv9):
Chromosome 24 (position 39396518)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38005607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGAGGACCTGAATGAAGCCAGCGACCCTGCATTATTAGCACGCTGCT[C/A]GGATTTCTTCATAAAACACGCTCAGTACCAGAAAGCTGTGGAATTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3253
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 1169 1455 28 32
ENSDART00000129889   None 774 None 18
Genomic Location (Zv9):
Chromosome 24 (position 39398032)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38007121
KASP Assay ID:
554-2487.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTTTGTAGTACCATGAGGCGCTCCAGTTGTGTTTGGACCAGAGTT[T/A]GACYATCACAGAAGATCTGGCTGAAAGTCTGACRGTGCCGAAAGACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046546 Nonsense 1351 1455 30 32
ENSDART00000129889   None 774 None 18
Genomic Location (Zv9):
Chromosome 24 (position 39400301)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38009390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCATACTGACTCACAGACTCGGCCTTATCAAGAGGTTCATTCAGGCA[C/T]GAAGGTAATGGTGAAATATGAACGGTTTATTTGTGTGTGGTATGTTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link