pard6ga

Ensembl ID:
ENSDARG00000031876
ZFIN ID:
ZDB-GENE-050923-1
Description:
par-6 partitioning defective 6 homolog gamma A [Source:RefSeq peptide;Acc:NP_001124131]
Human Orthologue:
PARD6G
Human Description:
par-6 partitioning defective 6 homolog gamma (C. elegans) [Source:HGNC Symbol;Acc:16076]
Mouse Orthologue:
Pard6g
Mouse Description:
par-6 partitioning defective 6 homolog gamma (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135606]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22843 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046844 Essential Splice Site 22 397 1 3
Genomic Location (Zv9):
Chromosome 16 (position 27632506)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25478193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGGCTCATTCGCTGCGCTGCTGCTCGATGCTCGAGGTCAAGAGTAAA[G/A]TAAGTTTCTTTATTCTCATTACTGATAGCTGCAGCGTCCGTTTCTGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link