trpa1b

Ensembl ID:
ENSDARG00000031875
ZFIN ID:
ZDB-GENE-050106-1
Description:
transient receptor potential cation channel, subfamily A, member 1b [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
TRPA1
Human Description:
transient receptor potential cation channel, subfamily A, member 1 [Source:HGNC Symbol;Acc:497]
Mouse Orthologue:
Trpa1
Mouse Description:
transient receptor potential cation channel, subfamily A, member 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16565 Nonsense Available for shipment Available now
sa11221 Essential Splice Site Available for shipment Available now
sa9365 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Nonsense 278 1120 8 28
ENSDART00000126769 Nonsense 278 1107 7 27
ENSDART00000148367 Nonsense 306 1148 8 28
Genomic Location:
Chromosome 24 (position 13579488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTTTTCGCAGAGTGGCAAATGCACRGCCCTCCACTTTGCCWGCAGT[C/T]AGGGTTCTCTGGAGGCTGTCAAAATCATGCTTTCCTCTTACAACAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Essential Splice Site 327 1120 9 28
ENSDART00000126769 Essential Splice Site 327 1107 8 27
ENSDART00000148367 Essential Splice Site 355 1148 9 28
Genomic Location:
Chromosome 24 (position 13588481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCHACGCTRTTTGATCACGTTGAGTTGGCTGAATATCTTATTTCAAAG[G/A]KAAATGTCTGAATGACTTGCTTTGTGAATAATCCAAACCCCAACCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Essential Splice Site 327 1120 9 28
ENSDART00000126769 Essential Splice Site 327 1107 8 27
ENSDART00000148367 Essential Splice Site 355 1148 9 28
Genomic Location:
Chromosome 24 (position 13588482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCYACGCTRTTTGATCACGTTGAGTTGGCTGAATATCTTATTTCAAAGR[T/G]AAATGTCTGAATGACTTGCTTTGTGAATAATCCAAACCCCAACCTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p32dhq0t