trpa1b

Ensembl ID:
ENSDARG00000031875
ZFIN ID:
ZDB-GENE-050106-1
Description:
transient receptor potential cation channel, subfamily A, member 1b [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
TRPA1
Human Description:
transient receptor potential cation channel, subfamily A, member 1 [Source:HGNC Symbol;Acc:497]
Mouse Orthologue:
Trpa1
Mouse Description:
transient receptor potential cation channel, subfamily A, member 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16565 Nonsense Available for shipment Available now
sa11221 Essential Splice Site Available for shipment Available now
sa9365 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30061 Nonsense Mutation detected in F1 DNA During 2016
sa37842 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Nonsense 278 1120 8 28
ENSDART00000126769 Nonsense 278 1107 7 27
ENSDART00000148367 Nonsense 306 1148 8 28
Genomic Location (Zv9):
Chromosome 24 (position 13579488)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13530936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTTTTCGCAGAGTGGCAAATGCACRGCCCTCCACTTTGCCWGCAGT[C/T]AGGGTTCTCTGGAGGCTGTCAAAATCATGCTTTCCTCTTACAACAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Essential Splice Site 327 1120 9 28
ENSDART00000126769 Essential Splice Site 327 1107 8 27
ENSDART00000148367 Essential Splice Site 355 1148 9 28
Genomic Location (Zv9):
Chromosome 24 (position 13588481)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13539929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCHACGCTRTTTGATCACGTTGAGTTGGCTGAATATCTTATTTCAAAG[G/A]KAAATGTCTGAATGACTTGCTTTGTGAATAATCCAAACCCCAACCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Essential Splice Site 327 1120 9 28
ENSDART00000126769 Essential Splice Site 327 1107 8 27
ENSDART00000148367 Essential Splice Site 355 1148 9 28
Genomic Location (Zv9):
Chromosome 24 (position 13588482)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13539930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCYACGCTRTTTGATCACGTTGAGTTGGCTGAATATCTTATTTCAAAGR[T/G]AAATGTCTGAATGACTTGCTTTGTGAATAATCCAAACCCCAACCTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Nonsense 610 1120 15 28
ENSDART00000126769 Nonsense 597 1107 14 27
ENSDART00000148367 Nonsense 638 1148 15 28
Genomic Location (Zv9):
Chromosome 24 (position 13595299)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13546747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGAAGCTGTGCGGAATGAGAGAAGAGAAGTAGTGAACGCCACCATT[G/T]AACATGAGCGGTAAGGAAATTCAAGGTCCATGAGGGTAGCCTTTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105997 Essential Splice Site 900 1120 23 28
ENSDART00000126769 Essential Splice Site 887 1107 22 27
ENSDART00000148367 Essential Splice Site 928 1148 23 28
Genomic Location (Zv9):
Chromosome 24 (position 13609935)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 13561383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTGCTGGCTTTCGGCTTGGCTTTCTACGCTCTGATGCTCCACAGGG[T/A]AAGTCCAAAAAGAGAGATCATATCATCCCAGCATGACAGACACGTCTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link