NP_694512.1

Ensembl ID:
ENSDARG00000031855
Description:
hepatocyte growth factor-like protein [Source:RefSeq peptide;Acc:NP_694512]
Human Orthologue:
MST1
Human Description:
macrophage stimulating 1 (hepatocyte growth factor-like) [Source:HGNC Symbol;Acc:7380]
Mouse Orthologue:
Mst1
Mouse Description:
macrophage stimulating 1 (hepatocyte growth factor-like) Gene [Source:MGI Symbol;Acc:MGI:96080]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33976 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12935 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045408 Essential Splice Site 405 709 10 18
Genomic Location (Zv9):
Chromosome 6 (position 53328334)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 53409057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAATCCTCTGCCAGAAATGGAGCATCAACACACCTCACAAAACCAAG[T/A]AAGACTGACGGATGGAAAATAATTATATAGGTACTCCAAAATCAACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045408 Essential Splice Site 609 709 16 18
Genomic Location (Zv9):
Chromosome 6 (position 53334025)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 53403366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTCCTGATGGGACCATCTGTGAAATTRCTGGATGGGGAGAAACTAAAG[G/A]TGAAACTTCTCACAACACCATTCACTTGAGGRCAGTAGGATTTTGAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link