pparg

Ensembl ID:
ENSDARG00000031848
ZFIN ID:
ZDB-GENE-990415-213
Description:
peroxisome proliferator-activated receptor gamma [Source:RefSeq peptide;Acc:NP_571542]
Human Orthologue:
PPARG
Human Description:
peroxisome proliferator-activated receptor gamma [Source:HGNC Symbol;Acc:9236]
Mouse Orthologue:
Pparg
Mouse Description:
peroxisome proliferator activated receptor gamma Gene [Source:MGI Symbol;Acc:MGI:97747]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35000 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1220 Nonsense Available for shipment Available now
sa27703 Nonsense Mutation detected in F1 DNA During 2017
sa1737 Nonsense Available for shipment Available now
sa34999 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039950 Essential Splice Site 106 431 3 7
Genomic Location (Zv9):
Chromosome 11 (position 627416)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 610248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAATCAGATGTGTTTAGTTTAATCGTCTTTCCGTTTGCTGTGTTTTCA[G/T]ACTCGATCAAGCTTGAGCCCGAATCTCCTCCACAGTTTGCAGAGAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039950 Nonsense 127 431 3 7
Genomic Location (Zv9):
Chromosome 11 (position 627353)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 610185
KASP Assay ID:
554-1129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCCCGAATCTCCTCCACAGTTTGCAGAGAACAGCGTTTCATTCTCC[A/T]AAACWCCTGAAGATCCGTCTTCATCCTCACTGAACATCGAGTGCCGAGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa27703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039950 Nonsense 142 431 3 7
Genomic Location (Zv9):
Chromosome 11 (position 627308)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 610140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCAAAACTCCTGAAGATCCGTCTTCATCCTCACTGAACATCGAGTGC[C/T]GAGTGTGTGGAGACAAAGCTTCGGGGTTTCATTACGGCGTTCACGCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039950 Nonsense 162 431 3 7
Genomic Location (Zv9):
Chromosome 11 (position 627248)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 610080
KASP Assay ID:
554-1682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACAAAGCTTCGGGGTTTCATTACGGCGTTCACGCCTGCGAGGGATGC[A/T]AGGTATTCAGCAGCAATACTTTTCAGTTATTGTGCCTGTAAATCAATAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039950 Nonsense 193 431 4 7
Genomic Location (Zv9):
Chromosome 11 (position 615815)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 598647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACTGCGACCTGCACTGCCGCATACACAAGAAGAGCCGCAACAAGTGC[C/T]AATACTGCCGCTTCCAGAAGTGCCTGATGGTGGGCATGTCACACAACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link