mboat2a

Ensembl ID:
ENSDARG00000031845
ZFIN ID:
ZDB-GENE-041210-257
Description:
Novel protein similar to mouse and human O-acyltransferase (Membrane bound) domain containing 2 (OAC
Human Orthologue:
MBOAT2
Human Description:
membrane bound O-acyltransferase domain containing 2 [Source:HGNC Symbol;Acc:25193]
Mouse Orthologue:
Mboat2
Mouse Description:
membrane bound O-acyltransferase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11956 Nonsense Available for shipment Available now
sa793 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
Genomic Location (Zv9):
Chromosome 17 (position 35170685)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35055609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCACAGATACTGCTTTGTGGTTACGATGGGATATCTCAGTTTCTG[T/A]CATGTCACCAGAGTCTATGTGTTTGACTACGGCATGTATTCAGCAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039663 Essential Splice Site 231 502 7 13
ENSDART00000146590 Essential Splice Site 205 476 6 12
Genomic Location (Zv9):
Chromosome 17 (position 35154137)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35039061
KASP Assay ID:
554-0698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGGCAAAGAGAACGGCAAATTCAAGCAGATCGAACCTTCACCGAAG[G/A]TAGAGTAAAAACTTAACTCTCTTGTTCCCTCTGGTGGCACAGAGAGGCTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link