mboat2a

Ensembl ID:
ENSDARG00000031845
ZFIN ID:
ZDB-GENE-041210-257
Description:
Novel protein similar to mouse and human O-acyltransferase (Membrane bound) domain containing 2 (OAC
Human Orthologue:
MBOAT2
Human Description:
membrane bound O-acyltransferase domain containing 2 [Source:HGNC Symbol;Acc:25193]
Mouse Orthologue:
Mboat2
Mouse Description:
membrane bound O-acyltransferase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914466]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4720 Nonsense Mutation detected in F1 DNA During 2014
sa11956 Nonsense Available for shipment Available now
sa793 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
Genomic Location:
Chromosome 17 (position 35170685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCACAGATACTGCTTTGTGGTTACGATGGGATATCTCAGTTTCTG[T/A]CATGTCACCAGAGTCTATGTGTTTGACTACGGCATGTATTCAGCAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
ENSDART00000039663 Nonsense 114 502 4 13
ENSDART00000146590 Nonsense 88 476 3 12
Genomic Location:
Chromosome 17 (position 35170685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCACAGATACTGCTTTGTGGTTACGATGGGATATCTCAGTTTCTG[T/A]CATGTCACCAGAGTCTATGTGTTTGACTACGGCATGTATTCAGCAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039663 Essential Splice Site 231 502 7 13
ENSDART00000146590 Essential Splice Site 205 476 6 12
Genomic Location:
Chromosome 17 (position 35154137)
KASP Assay ID:
554-0698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGGCAAAGAGAACGGCAAATTCAAGCAGATCGAACCTTCACCGAAG[G/A]TAGAGTAAAAACTTAACTCTCTTGTTCCCTCTGGTGGCACAGAGAGGCTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/spg1kiab