eif4ebp2

Ensembl ID:
ENSDARG00000031819
ZFIN ID:
ZDB-GENE-031118-83
Description:
eukaryotic translation initiation factor 4E-binding protein 2 [Source:RefSeq peptide;Acc:NP_997968]
Human Orthologues:
EIF4EBP2, EIF4EBP3
Human Descriptions:
eukaryotic translation initiation factor 4E binding protein 2 [Source:HGNC Symbol;Acc:3289]
eukaryotic translation initiation factor 4E binding protein 3 [Source:HGNC Symbol;Acc:3290]
Mouse Orthologues:
Eif4ebp2, Eif4ebp3
Mouse Descriptions:
eukaryotic translation initiation factor 4E binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:109198
eukaryotic translation initiation factor 4E binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:127084

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12610 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040926 Splice Site, Nonsense 105 113 3 3
Genomic Location:
Chromosome 13 (position 30390157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTAGTGGTCATGCATGACASTTTTTGTGTGTGTCTGTGYTRCAGGT[G/T]AAGATGCTCAGTTTGAGATGGACATCTAAAGAAGAGGAACCTACGTGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5o7aue3e