rbm24b

Ensembl ID:
ENSDARG00000031809
ZFIN ID:
ZDB-GENE-060312-43
Description:
RNA binding motif protein 24b [Source:RefSeq peptide;Acc:NP_001035014]
Human Orthologue:
RBM24
Human Description:
RNA binding motif protein 24 [Source:HGNC Symbol;Acc:21539]
Mouse Orthologue:
Rbm24
Mouse Description:
RNA binding motif protein 24 Gene [Source:MGI Symbol;Acc:MGI:3610364]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22961 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045792 Nonsense 127 142 4 5
ENSDART00000127556 Nonsense 127 245 4 6
Genomic Location (Zv9):
Chromosome 16 (position 56995874)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53578439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTTCTTGTTGCAGAGACAGCGAGGATGATCATTCTCCATTACTGTA[T/A]CCTCCTCCTTTCCGCCAGGTCATGAGGTGTGTGTTTGCGTGTGTGTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link