abcf1

Ensembl ID:
ENSDARG00000031795
ZFIN ID:
ZDB-GENE-050517-31
Description:
ATP-binding cassette sub-family F member 1 [Source:RefSeq peptide;Acc:NP_998351]
Human Orthologue:
ABCF1
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:70]
Mouse Orthologue:
Abcf1
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 1 Gene [Source:MGI Symbol;Acc:MGI:1351658]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7881 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19215 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23550 Nonsense Mutation detected in F1 DNA During 2014
sa23549 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 31688404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGGAAAAAGGGCAAGAAAGCTGCTGCAGCTGCTAAACCATCTAAGG[T/C]TAGTGAYTCTTGTTTTGAKGATTGATTRRTTTCAAAGAGGCGTTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31
ENSDART00000048977 Essential Splice Site 212 877 None 27
ENSDART00000073705 Essential Splice Site 192 241 None 9
ENSDART00000112123 Essential Splice Site 192 274 None 26
ENSDART00000113290 Essential Splice Site 179 845 None 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 31688404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGAAAAAGGGCAAGAAAGCTGCTGCAGCTGCTAAACCATCTAAGG[T/C]TAGTGACTCTTGTTTTGATGATTGATTGGTTTCAAAGAGGCGTTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 None None 877 None 27
ENSDART00000073705 None None 241 None 9
ENSDART00000112123 None None 274 None 26
ENSDART00000113290 Nonsense 264 845 15 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 31687370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGTTTGTTGTAGCGTCAACCAAACCACAAGAGCTGCAGAATGTTTA[T/A]GTATATTCTATTTATGAAGCCATACTTATCTATGCATTAATTGCATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Nonsense 719 877 23 27
ENSDART00000073705 None None 241 None 9
ENSDART00000112123 None None 274 22 26
ENSDART00000113290 Nonsense 687 845 27 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 31678525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAGCTTTTCTTTATTTTAGACAAAAGGAGAGATGAGGAAGAACCAT[C/T]GATTGGTAAGCCAGATGTATAAAATCACTCGACTTATTGTCACCACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/80oums2v