abcf1

Ensembl ID:
ENSDARG00000031795
ZFIN ID:
ZDB-GENE-050517-31
Description:
ATP-binding cassette sub-family F member 1 [Source:RefSeq peptide;Acc:NP_998351]
Human Orthologue:
ABCF1
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 1 [Source:HGNC Symbol;Acc:70]
Mouse Orthologue:
Abcf1
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 1 Gene [Source:MGI Symbol;Acc:MGI:1351658]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23550 Nonsense Mutation detected in F1 DNA During 2016
sa23549 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977   None 877 None 27
ENSDART00000073705   None 241 None 9
ENSDART00000112123   None 274 None 26
ENSDART00000113290 Nonsense 264 845 15 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31687370)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30854659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGTTTGTTGTAGCGTCAACCAAACCACAAGAGCTGCAGAATGTTTA[T/A]GTATATTCTATTTATGAAGCCATACTTATCTATGCATTAATTGCATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048977 Nonsense 719 877 23 27
ENSDART00000073705   None 241 None 9
ENSDART00000112123   None 274 22 26
ENSDART00000113290 Nonsense 687 845 27 31

The following transcripts of ENSDARG00000031795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31678525)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30845814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAGCTTTTCTTTATTTTAGACAAAAGGAGAGATGAGGAAGAACCAT[C/T]GATTGGTAAGCCAGATGTATAAAATCACTCGACTTATTGTCACCACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link