adcy8

Ensembl ID:
ENSDARG00000031783
ZFIN ID:
ZDB-GENE-070912-197
Description:
adenylate cyclase type 8 [Source:RefSeq peptide;Acc:NP_001137224]
Human Orthologue:
ADCY8
Human Description:
adenylate cyclase 8 (brain) [Source:HGNC Symbol;Acc:239]
Mouse Orthologue:
Adcy8
Mouse Description:
adenylate cyclase 8 Gene [Source:MGI Symbol;Acc:MGI:1341110]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38352 Nonsense Mutation detected in F1 DNA During 2016
sa39913 Nonsense Mutation detected in F1 DNA During 2016
sa16359 Nonsense Available for shipment Available now
sa39912 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30826 Nonsense Mutation detected in F1 DNA During 2016
sa39911 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 80 886 3 17
ENSDART00000134139 Nonsense 75 881 2 16
ENSDART00000137913   None 312 None 6
ENSDART00000140913   None 246 None 6
Genomic Location (Zv9):
Chromosome 2 (position 42962709)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43012173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACACTCTCCGCTCAGGAACTTGTTCGAATGCTCAACGAACTCTTTGCA[C/T]GATTCGACCGACTGGCACACGTAAGTAAACACACTTTTACCAGAATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 90 886 4 17
ENSDART00000134139 Nonsense 85 881 3 16
ENSDART00000137913 Nonsense 4 312 1 6
ENSDART00000140913   None 246 None 6
Genomic Location (Zv9):
Chromosome 2 (position 42944904)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42994368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTATGGTTTGACATCTTTCTTCTTTTCCCCTCAGGAGCATCATTG[T/A]CTGAGGATCAAGATACTGGGGGATTGTTATTATTGTGTTTCTGGCCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 101 886 4 17
ENSDART00000134139 Nonsense 96 881 3 16
ENSDART00000137913 Nonsense 15 312 1 6
ENSDART00000140913   None 246 None 6
Genomic Location (Zv9):
Chromosome 2 (position 42944871)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42994335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGGAGCATCATTGTCTGAGGATCAAGATACTGGGGGATTGTTATTA[T/G]TGTGTTTCTGGCCTTCCTGAGCCTCGGCCAGATCATGCTCACTGCTGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Essential Splice Site 182 886 5 17
ENSDART00000134139 Essential Splice Site 177 881 4 16
ENSDART00000137913 Essential Splice Site 96 312 2 6
ENSDART00000140913   None 246 None 6
Genomic Location (Zv9):
Chromosome 2 (position 42941219)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42990683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGGATGTGGACATAGCCAACAAACTGGAGTCGGGGGGAATACCTGGG[T/A]AAGACACACTGATGCAATCTCTCATTCACACATTTTCCACCCTCATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 441 886 10 17
ENSDART00000134139 Nonsense 436 881 9 16
ENSDART00000137913 Nonsense 289 312 6 6
ENSDART00000140913 Nonsense 191 246 5 6
Genomic Location (Zv9):
Chromosome 2 (position 42916415)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42965879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAAACACTTGCCCTGTCTGTCTGTCTCTCTCTTGTATTGCAGCTTTG[G/A]TGTGATTTTGATAAATCGGGCTCATTCAGGAACCAGACGTTTAATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 572 886 13 17
ENSDART00000134139 Nonsense 567 881 12 16
ENSDART00000137913   None 312 None 6
ENSDART00000140913   None 246 None 6
Genomic Location (Zv9):
Chromosome 2 (position 42887786)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42937250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATATACGGCTCGTCTGGACTTCCTATGGCGTGTGCAGGCGAAGGAA[G/T]AGATAAATGAGATGCGAGAGCTGCGTGAGCACAATGAGAACATGCTCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link