adcy8

Ensembl ID:
ENSDARG00000031783
ZFIN ID:
ZDB-GENE-070912-197
Description:
adenylate cyclase type 8 [Source:RefSeq peptide;Acc:NP_001137224]
Human Orthologue:
ADCY8
Human Description:
adenylate cyclase 8 (brain) [Source:HGNC Symbol;Acc:239]
Mouse Orthologue:
Adcy8
Mouse Description:
adenylate cyclase 8 Gene [Source:MGI Symbol;Acc:MGI:1341110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087823 Nonsense 101 886 4 17
ENSDART00000134139 Nonsense 96 881 3 16
ENSDART00000137913 Nonsense 15 312 1 6
ENSDART00000140913 None None 246 None 6
Genomic Location:
Chromosome 2 (position 42944871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGGAGCATCATTGTCTGAGGATCAAGATACTGGGGGATTGTTATTA[T/G]TGTGTTTCTGGCCTTCCTGAGCCTCGGCCAGATCATGCTCACTGCTGCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ur0sjxub