si:ch73-374a13.2

Ensembl ID:
ENSDARG00000031782
ZFIN ID:
ZDB-GENE-041008-100
Human Orthologue:
AIM1
Human Description:
absent in melanoma 1 [Source:HGNC Symbol;Acc:356]
Mouse Orthologue:
Aim1
Mouse Description:
absent in melanoma 1 Gene [Source:MGI Symbol;Acc:MGI:109544]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15726 Essential Splice Site Available for shipment Available now
sa23087 Nonsense Available for shipment Available now
sa36420 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Essential Splice Site 247 1001 None 23
ENSDART00000139451   204 947 1 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25370114)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25510033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTGAATCTGACTTCCAACACGTCTAAWTCAAASATTGTGCTGCAAGG[C/G]ATATCAGGATTAACATCTCCATCAGACATCACTCAGCAGATTCCATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Nonsense 413 1001 9 23
ENSDART00000139451 Nonsense 361 947 5 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25372630)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25512549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAGCACACCACAAATTGACCTGTTCACAGAGCTCAATGGGATGGGC[C/T]GAATATCTTCATACTGCGATGACACAATAGAAACCTGTTCTTTTGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041721 Nonsense 517 1001 12 23
ENSDART00000139451 Nonsense 465 947 8 19

The following transcripts of ENSDARG00000031782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25376175)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25516094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCCGATGTTTCAAGGGGAGTGCATGGAGATAGAAAGAGACATTTA[C/A]AACTTTGGAGAGGTAGAGGAGAATGAAGAAGAGGAGACTGACAGCACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stroke: A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link