myst2

Ensembl ID:
ENSDARG00000031770
ZFIN ID:
ZDB-GENE-030131-1901
Description:
histone acetyltransferase MYST2 [Source:RefSeq peptide;Acc:NP_997800]
Human Orthologue:
MYST2
Human Description:
MYST histone acetyltransferase 2 [Source:HGNC Symbol;Acc:17016]
Mouse Orthologue:
Myst2
Mouse Description:
MYST histone acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2182799]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38873 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004896 Nonsense 139 568 4 15
ENSDART00000142659   None 102 None 3

The following transcripts of ENSDARG00000031770 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6677593)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5960513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCGATCCCTCTCATCGGCCAAAACGCCGCCGCTTTCATGAGAGCTA[C/A]AACTTCAATATGAAGTGCCCCACACCTGGGTGCAATTCTCTGGGTAATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link