roraa

Ensembl ID:
ENSDARG00000031768
ZFIN IDs:
ZDB-GENE-060306-2, ZDB-GENE-060306-2
Description:
nuclear receptor ROR-alpha [Source:RefSeq peptide;Acc:NP_001103637]
Human Orthologue:
RORA
Human Description:
RAR-related orphan receptor A [Source:HGNC Symbol;Acc:10258]
Mouse Orthologue:
Rora
Mouse Description:
RAR-related orphan receptor alpha Gene [Source:MGI Symbol;Acc:MGI:104661]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15121 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032289 None None 467 None 10
ENSDART00000121449 Essential Splice Site 59 516 1 10
Genomic Location:
Chromosome 25 (position 34896510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGACCGCCGAGCTTAATGATGTATTTTGTGMTTTCAGCTATGAAAGG[T/G]AAGAGGARAGAAGCAAGCTGGGGNNNTTTTTTTTATTTGTCTGGGGCTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m460pkfv