tmc4

Ensembl ID:
ENSDARG00000031757
ZFIN ID:
ZDB-GENE-030131-7489
Human Orthologue:
TMC4
Human Description:
transmembrane channel-like 4 [Source:HGNC Symbol;Acc:22998]
Mouse Orthologue:
Tmc4
Mouse Description:
transmembrane channel-like gene family 4 Gene [Source:MGI Symbol;Acc:MGI:2669035]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17316 Nonsense Available for shipment Available now
sa15301 Nonsense Available for shipment Available now
sa25020 Nonsense Mutation detected in F1 DNA During 2014
sa9506 Nonsense Available for shipment Available now
sa18068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041054 Nonsense 152 732 4 16
Genomic Location:
Chromosome 16 (position 34350787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTATTCCTGAGATTTCTGGTGATTCTCAACTTTCTGTCCTCTTTGT[T/A]AATCGCAGCGTTTGTGCTCATTCCCAGCATTGTGTTTCGCTCCTTGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041054 Nonsense 255 732 6 16
Genomic Location:
Chromosome 16 (position 34353472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCCTACCTGTTGACWGCAGCTTTCTACTTCCTCTTCTGCTTCTTTTG[T/A]ATAAYTATTAGGTGAGTCAGCTTTTGTCAGAGTTGTTAGAACATTGCTST
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041054 Nonsense 427 732 10 16
Genomic Location:
Chromosome 16 (position 34358001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGTAGGGCAGTGTTCTTGCGTTTGGTCAGTTTGGGTGTTTTGCTGTA[C/A]ACTCTATGGGAGCAGATAACCTGTAAAGGAGAGATTGGCAGTGATGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041054 Nonsense 573 732 13 16
Genomic Location:
Chromosome 16 (position 34360394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACCGGCAACAAGAAACTTCAGATCCACCACCTCCAAYTTCTTCTTTY[T/A]GTTGGTTCTGCTCTTTGGATGGATGTTGGCCAGTGTGGTTCTGCTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041054 Essential Splice Site 593 732 13 16
Genomic Location:
Chromosome 16 (position 34360455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTGGATGGATGTTGGCCAGTGTGGTTCTGCTTTACAGTGTTGCTAA[G/A]TGAGTGATTCTCCTCCATAAATGTTGGGAAATATTTYCATCTTCTATGRC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dvtkm85i