mef2a

Ensembl ID:
ENSDARG00000031756
ZFIN ID:
ZDB-GENE-990415-163
Description:
myocyte-specific enhancer factor 2A [Source:RefSeq peptide;Acc:NP_571376]
Human Orthologue:
MEF2A
Human Description:
myocyte enhancer factor 2A [Source:HGNC Symbol;Acc:6993]
Mouse Orthologue:
Mef2a
Mouse Description:
myocyte enhancer factor 2A Gene [Source:MGI Symbol;Acc:MGI:99532]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29039 Nonsense Mutation detected in F1 DNA During 2017
sa43112 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005740 Nonsense 94 488 3 10
ENSDART00000019290 Nonsense 138 525 5 11
ENSDART00000078969   None 458 None 10
ENSDART00000080202 Nonsense 124 510 4 10
ENSDART00000124818 Nonsense 138 524 4 10
ENSDART00000147446   None 487 None 10
ENSDART00000148106   None 458 None 10

The following transcripts of ENSDARG00000031756 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 23091446)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23321669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTTTTTATGTTGATGTTTACTACAGGCGCTTAACAAGAAAGAACAC[A/T]GAGGCTGTGATAGCCCGGATCCTGATGCCTCATATGTCCTCACCCCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005740 Nonsense 135 488 4 10
ENSDART00000019290 Nonsense 179 525 6 11
ENSDART00000078969 Nonsense 134 458 6 10
ENSDART00000080202 Nonsense 165 510 5 10
ENSDART00000124818 Nonsense 179 524 5 10
ENSDART00000147446 Nonsense 134 487 4 10
ENSDART00000148106 Nonsense 134 458 6 10

The following transcripts of ENSDARG00000031756 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 23094217)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23324440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCACATGAAGCCATATTTGTGTGTGATTCTCTTCCAGCCGACGGCCT[T/A]GCCCCCGCAAAACTTCTCCATGCATGTGGCTGTGCCAGTGACGAACCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link