npr1a

Ensembl ID:
ENSDARG00000031751
ZFIN ID:
ZDB-GENE-060503-539
Description:
atrial natriuretic peptide receptor 1 [Source:RefSeq peptide;Acc:NP_001038402]
Human Orthologue:
NPR1
Human Description:
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) [Source:HGN
Mouse Orthologue:
Npr1
Mouse Description:
natriuretic peptide receptor 1 Gene [Source:MGI Symbol;Acc:MGI:97371]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15690 Nonsense Available for shipment Available now
sa29215 Nonsense Mutation detected in F1 DNA During 2017
sa39249 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10670 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041298 Nonsense 277 1067 2 21
ENSDART00000136244   None 672 None 17
Genomic Location (Zv9):
Chromosome 19 (position 26969451)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26899563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAAGTTGATGGTGGAGTTCTGGAGGCAGGGTTTTCCTCAGGAGGAGTA[C/A]GCTTTCTTCTTCATCGACCTGTTTGGACGCAGTTTGCAGAGCCATCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041298 Nonsense 505 1067 8 21
ENSDART00000136244 Nonsense 110 672 4 17
Genomic Location (Zv9):
Chromosome 19 (position 27066225)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26996337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTGTCTCTCGGCGTGTTTCTCTGTCCGCCATCAGGAAGCTGAAGT[T/A]GGAGAATGAGTTGACCGCTCAGCTGTGGCGTGTGCACTGGGAGGACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041298 Essential Splice Site 542 1067 9 21
ENSDART00000136244 Essential Splice Site 147 672 5 17
Genomic Location (Zv9):
Chromosome 19 (position 27067713)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26997825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCAAATGAGTCAGCAAACTAATGTCCTGTTAAAATCTTTTGCACACA[G/T]AGAGGCTCTAACTATGGGTCACTGCTCACTATGGATGGAAACTTCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041298 Nonsense 767 1067 15 21
ENSDART00000136244 Nonsense 372 672 11 17
Genomic Location (Zv9):
Chromosome 19 (position 27100211)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27030323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTWGGTTCTGTGTTTTAGAGATCATCGARCGTGTGGTGGAGGGCCGCTG[G/A]CCRTACCTGCGTCCCCTACTGTGTCCTCAGAGTCACAGTGAGGAGATGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link