clstn1

Ensembl ID:
ENSDARG00000031720
ZFIN ID:
ZDB-GENE-040426-1064
Description:
calsyntenin 1 [Source:RefSeq peptide;Acc:NP_001071252]
Human Orthologue:
CLSTN1
Human Description:
calsyntenin 1 [Source:HGNC Symbol;Acc:17447]
Mouse Orthologue:
Clstn1
Mouse Description:
calsyntenin 1 Gene [Source:MGI Symbol;Acc:MGI:1929895]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16000 Essential Splice Site Available for shipment Available now
sa14307 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049985 Essential Splice Site 28 317 None 10
ENSDART00000059339 Essential Splice Site 28 964 None 18
ENSDART00000129248 Essential Splice Site 28 971 None 18
ENSDART00000130780 Essential Splice Site 28 317 None 13
ENSDART00000133902 Essential Splice Site 28 954 None 17
Genomic Location:
Chromosome 23 (position 29910353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCGGTCTGCTTTTAGGACTATTATACGCGGTGGAKKCAGCCAAAGG[T/A]AAGATTTAAGAGCGTTTTGATCCATTGCCAGTGACAARATGTGAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049985 Nonsense 176 317 5 10
ENSDART00000059339 Nonsense 176 964 5 18
ENSDART00000129248 Nonsense 166 971 4 18
ENSDART00000130780 Nonsense 176 317 5 13
ENSDART00000133902 Nonsense 166 954 4 17
Genomic Location:
Chromosome 23 (position 29855541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCAAAGAGAAGTCCTACAAAGCCACAGTAATCGAGGGCAAGAAGTA[C/A]GACAGCATCATGAAGGTGGAGGCCGTGGAYGCAGACTGCTCTTTCCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/exc8vg5m