lyn

Ensembl ID:
ENSDARG00000031715
ZFIN ID:
ZDB-GENE-040912-7
Description:
tyrosine-protein kinase Lyn [Source:RefSeq peptide;Acc:NP_001004543]
Human Orthologue:
LYN
Human Description:
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog [Source:HGNC Symbol;Acc:6735]
Mouse Orthologue:
Lyn
Mouse Description:
Yamaguchi sarcoma viral (v-yes-1) oncogene homolog Gene [Source:MGI Symbol;Acc:MGI:96892]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39845 Nonsense Mutation detected in F1 DNA During 2016
sa19779 Nonsense Available for shipment Available now
sa14305 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040555 Nonsense 108 510 5 13
Genomic Location (Zv9):
Chromosome 2 (position 27750115)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27946311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAGGCATGGCGAGTGGTGGAAAGCGAGGTCTTTGACCACACGAAAA[G/T]AAGGTTTCATTCCCTCAAACTATGTTGCAGAAGCAGACACTATGGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040555 Nonsense 182 510 7 13
Genomic Location (Zv9):
Chromosome 2 (position 27745698)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27941894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGATCAGAGACGTAGACGCTCAGGGCCAGGATGTTGTTAAACATTAT[A/T]AGATCAGATCTCTGGATAATGGCGGTTACTACATCTCCCCAAAGATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040555 Nonsense 329 510 10 13
Genomic Location (Zv9):
Chromosome 2 (position 27735607)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27931803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTAACAGWATTTCGTTTATTCTTTTGCAGGAAGCTTATTGGATTTCT[T/A]GAAAAGTCAAGCTGGCTCCAAAATACAGTTACCAAAGTTGATAGATTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link