grm3

Ensembl ID:
ENSDARG00000031712
ZFIN ID:
ZDB-GENE-061009-13
Description:
metabotropic glutamate receptor 3 [Source:RefSeq peptide;Acc:NP_001121815]
Human Orthologue:
GRM3
Human Description:
glutamate receptor, metabotropic 3 [Source:HGNC Symbol;Acc:4595]
Mouse Orthologue:
Grm3
Mouse Description:
glutamate receptor, metabotropic 3 Gene [Source:MGI Symbol;Acc:MGI:1351340]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36575 Nonsense Mutation detected in F1 DNA During 2017
sa19195 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047309 Nonsense 347 884 2 5
ENSDART00000134224 Nonsense 347 884 3 6
Genomic Location (Zv9):
Chromosome 18 (position 8470624)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9048002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACTTCCAGACCCTCACGCCCCAAATTAACCATCGCAACCCCTGGTTC[A/T]AAGACTTCTGGGAGCAAAAGTTTCAGTGTTCATTGGGTGGGACGTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047309 Nonsense 732 884 3 5
ENSDART00000134224 Nonsense 732 884 4 6
Genomic Location (Zv9):
Chromosome 18 (position 8447047)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9024425
KASP Assay ID:
2261-1868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTACGCGGCGGTTCACCACGCCAGAGAAACGCCAGACTGTCATTTTG[A/T]AGTGCAATGTAAGGGACTCTAGCATGCTGATGTCGCTGAGCTACGATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brachial circumference: Genome-wide association study to identify common variants associated with brachial circumference: a meta-analysis of 14 cohorts. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link