mylk2

Ensembl ID:
ENSDARG00000031698
ZFIN ID:
ZDB-GENE-080616-2
Description:
myosin light chain kinase 2-like [Source:RefSeq peptide;Acc:NP_001103990]
Human Orthologue:
MYLK2
Human Description:
myosin light chain kinase 2 [Source:HGNC Symbol;Acc:16243]
Mouse Orthologue:
Mylk2
Mouse Description:
myosin, light polypeptide kinase 2, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:2139434]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5060 Nonsense Mutation detected in F1 DNA During 2014
sa24378 Nonsense Mutation detected in F1 DNA During 2014
sa19331 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Nonsense 328 555 5 12
ENSDART00000133801 Nonsense 527 777 9 16
Genomic Location:
Chromosome 23 (position 32291664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGCAGGTCATGAACCAGCTGAGCCACCCCAACATCCTCCAGCTTTA[T/A]GAGGCCTTCGAGGTCAAGAATCAAGTCGTGCTCATCCTGGAATAGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Nonsense 418 555 8 12
ENSDART00000133801 Nonsense 617 777 12 16
Genomic Location:
Chromosome 23 (position 32294935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATGCTTTGACTAACTTTTCTCTTTGTCCCTCTTCAGATATAAACCA[C/T]GAGAGAAGCTCAAAGTTTCATTTGGAACGCCTGAGTTTTTAGCTCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Essential Splice Site 552 555 11 12
ENSDART00000133801 Essential Splice Site 751 777 15 16
Genomic Location:
Chromosome 23 (position 32297926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTCACAGGTTCTCCTCAAGAAATACATGGCCAGGCGATTGTGGAAGG[T/G]AAAACACTGTGTTTAGAAAGTGGCAGATCATTGTGTCCTCAGTTTTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gbeztz1l