mylk2

Ensembl ID:
ENSDARG00000031698
ZFIN ID:
ZDB-GENE-080616-2
Description:
myosin light chain kinase 2-like [Source:RefSeq peptide;Acc:NP_001103990]
Human Orthologue:
MYLK2
Human Description:
myosin light chain kinase 2 [Source:HGNC Symbol;Acc:16243]
Mouse Orthologue:
Mylk2
Mouse Description:
myosin, light polypeptide kinase 2, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:2139434]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24378 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048628 Nonsense 418 555 8 12
ENSDART00000133801 Nonsense 617 777 12 16
Genomic Location (Zv9):
Chromosome 23 (position 32294935)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32129825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATGCTTTGACTAACTTTTCTCTTTGTCCCTCTTCAGATATAAACCA[C/T]GAGAGAAGCTCAAAGTTTCATTTGGAACGCCTGAGTTTTTAGCTCCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link