atp6v0b

Ensembl ID:
ENSDARG00000031681
ZFIN ID:
ZDB-GENE-030131-443
Description:
V-type proton ATPase 21 kDa proteolipid subunit [Source:RefSeq peptide;Acc:NP_955855]
Human Orthologue:
ATP6V0B
Human Description:
ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b [Source:HGNC Symbol;Acc:861]
Mouse Orthologue:
Atp6v0b
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit B Gene [Source:MGI Symbol;Acc:MGI:1890510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2046 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2046
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045011 Essential Splice Site 22 205 1 8
ENSDART00000147439 Essential Splice Site 23 206 1 8
Genomic Location:
Chromosome 2 (position 33404829)
KASP Assay ID:
554-2913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATACACCGGGGTCACTTTGGCCTTCTGGTCGACTATGGTGATCGTCG[G/A]TAAGTGCTAATAAAACCTTTTAAAACATACATAGAATGAACACTCTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nv0bp4z2