ercc1

Ensembl ID:
ENSDARG00000031680
ZFIN ID:
ZDB-GENE-040426-2606
Description:
DNA excision repair protein ERCC-1 [Source:RefSeq peptide;Acc:NP_001096608]
Human Orthologue:
ERCC1
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes over
Mouse Orthologue:
Ercc1
Mouse Description:
excision repair cross-complementing rodent repair deficiency, complementation group 1 Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041751 Nonsense 228 342 5 9
Genomic Location:
Chromosome 9 (position 33710562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACATCATTGATCAGAAAGACCCTCATCATGCACTGAAAGAGCTTGCA[C/T]GAATATGCATCATGGCTGACTGTACCCTCATCTTGGCCTGGAGGTAACSG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nz7pi4i7