si:ch211-198b21.5

Ensembl ID:
ENSDARG00000031678
ZFIN IDs:
ZDB-GENE-030616-13, ZDB-GENE-030616-13, ZDB-GENE-030616-13, ZDB-GENE-040724-3, ZDB-GENE-081104-515
Description:
collagen alpha-2(V) chain [Source:RefSeq peptide;Acc:NP_001139254]
Human Orthologue:
COL5A2
Human Description:
collagen, type V, alpha 2 [Source:HGNC Symbol;Acc:2210]
Mouse Orthologue:
Col5a2
Mouse Description:
collagen, type V, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88458]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13820 Nonsense Available for shipment Available now
sa34725 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7208 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14075 Nonsense Available for shipment Available now
sa7207 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8629 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16186 Essential Splice Site Available for shipment Available now
sa13316 Essential Splice Site Available for shipment Available now
sa657 Essential Splice Site F2 line generated During 2017
sa31741 Nonsense Available for shipment Available now
sa11735 Essential Splice Site Available for shipment Available now
sa21557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544 Nonsense 74 171 2 7
ENSDART00000041807 Nonsense 161 1575 2 54
ENSDART00000048817 Nonsense 46 1259 1 45
ENSDART00000144744 Nonsense 107 1521 2 54
Genomic Location (Zv9):
Chromosome 9 (position 43746754)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42871924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAACCATCCTGTGCGATGAGGTACAATGTGATGAGGTGTCGAACTG[T/A]GCAAAGGTAGTGATCCCACCGGGAGAGTGCTGTCCGGTCTGCCAGGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 357 1575 13 54
ENSDART00000048817   None 1259 None 45
ENSDART00000144744 Essential Splice Site 303 1521 13 54
Genomic Location (Zv9):
Chromosome 9 (position 43741712)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42866882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGTGGTGTTGTTTGAATTTGCATTAATGGCTCACTAACATCTGTGCTC[A/G]GGGAGGAAGAGGATTTCCAGGGACACCGGGGCCCCCAGGCTTAAAGGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 557 1575 22 54
ENSDART00000048817 Essential Splice Site 297 1259 15 45
ENSDART00000144744 Essential Splice Site 503 1521 22 54
Genomic Location (Zv9):
Chromosome 9 (position 43736822)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42861992
KASP Assay ID:
554-4803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAGGTGTTGCTGGATTTAAAGGAGAGGCTGGACCTAAAGGAGAACCT[G/A]TAGGTTATGATTTCTAANNNGTGAAAAAGCYAAGAGGTTGGGTTTTTTNNAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Nonsense 567 1575 23 54
ENSDART00000048817 Nonsense 307 1259 16 45
ENSDART00000144744 Nonsense 513 1521 23 54
Genomic Location (Zv9):
Chromosome 9 (position 43736710)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42861880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATTGCCTTTGTGGCTTTTNAGGGTCCACCAGGATCACAGGGAGTACTT[G/T]GACCTCAGGGAGAGGAGGGAAAACRTGGACCCAGAGGAGATYCTGGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 645 1575 26 54
ENSDART00000048817 Essential Splice Site 385 1259 19 45
ENSDART00000144744 Essential Splice Site 591 1521 26 54
Genomic Location (Zv9):
Chromosome 9 (position 43736201)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42861371
KASP Assay ID:
554-4262.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAGTTTAAAATATAGCTCTGGTTATTTTTTTGCATCCTTTGTTTCAC[A/T]GGGTTTGACAGGTACGCCTGGAGTTCAGGGTGCTGAAGGAAAACCAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 731 1575 29 54
ENSDART00000048817 Essential Splice Site 471 1259 22 45
ENSDART00000144744 Essential Splice Site 677 1521 29 54
Genomic Location (Zv9):
Chromosome 9 (position 43735503)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42860673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGGCAAAGATGGAGAAGTAGGCCCAGCTGGTCCACCAGGTCCACAT[G/T]TAAGKGTCCCATTCCTACTTATACATTAGTGTGTGTGTNNTGTGATGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 732 1575 30 54
ENSDART00000048817 Essential Splice Site 472 1259 23 45
ENSDART00000144744 Essential Splice Site 678 1521 30 54
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 732 1575 30 54
ENSDART00000048817 Essential Splice Site 472 1259 23 45
ENSDART00000144744 Essential Splice Site 678 1521 30 54
Genomic Location (Zv9):
Chromosome 9 (position 43735382)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42860552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCAGAGCAACTCTATGAAAACTCTATGTTTTCWTTTTTTGATTTTC[A/T]GGGTACAGCAGGCGAGCGAGGTGAACAGGGACCYCCTGGAATGCACRGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 732 1575 30 54
ENSDART00000048817 Essential Splice Site 472 1259 23 45
ENSDART00000144744 Essential Splice Site 678 1521 30 54
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 732 1575 30 54
ENSDART00000048817 Essential Splice Site 472 1259 23 45
ENSDART00000144744 Essential Splice Site 678 1521 30 54
Genomic Location (Zv9):
Chromosome 9 (position 43735382)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42860552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCAGAGCAACTCTATGAAAACTCTATGTTTTCWTTTTTTGATTTTC[A/T]GGGTACAGCAGGCGAGCGAGGTGAACAGGGACCYCCTGGAATGCACRGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa657
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 815 1575 33 54
ENSDART00000048817   None 1259 None 45
ENSDART00000144744 Essential Splice Site 761 1521 33 54
Genomic Location (Zv9):
Chromosome 9 (position 43734827)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42859997
KASP Assay ID:
554-0565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTGGAGCCAAAGGTATCCCAGGAGCACCTGGTCCTGATGGCCCAAAG[G/A]TAGAAAATAAATTAGATAAGATCATATTTGCTATTGATGCTTTTAAAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Nonsense 1040 1575 42 54
ENSDART00000048817 Nonsense 729 1259 33 45
ENSDART00000144744 Nonsense 986 1521 42 54
Genomic Location (Zv9):
Chromosome 9 (position 43733036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42858206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCCAAGGAGAAAGAGGCCCCCCTGGGCCTGCTGGAGGCCCTGGGGAC[A/T]AAGGAGATTCTGGAGAAGATGGACCACCAGTAAGTGCGCATCAGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Essential Splice Site 1085 1575 43 54
ENSDART00000048817 Essential Splice Site 774 1259 34 45
ENSDART00000144744 Essential Splice Site 1031 1521 43 54
Genomic Location (Zv9):
Chromosome 9 (position 43732818)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42857988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGGTCAAAGAGGAGAGYGTGGAATGGCAGGACTCCCTGGACCTGCAG[T/G]TAGTATCCATTAAAAANCATTTAAAATTATGAAAAAAGTTCTCAAACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033544   None 171 None 7
ENSDART00000041807 Nonsense 1213 1575 48 54
ENSDART00000048817 Nonsense 902 1259 39 45
ENSDART00000144744 Nonsense 1159 1521 48 54
Genomic Location (Zv9):
Chromosome 9 (position 43731818)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42856988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGACCAAGGGGAGATAAGGGTGATATTGGTGACCATGGGGAAAGAGGA[C/T]AGAAGGGTCATAGAGGATTTGCAGGCTTACAAGGTCTTCCTGGATCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link