si:ch211-207d6.2

Ensembl ID:
ENSDARG00000031658
ZFIN ID:
ZDB-GENE-070912-185
Human Orthologue:
KIAA1217
Human Description:
KIAA1217 [Source:HGNC Symbol;Acc:25428]
Mouse Orthologue:
Etl4
Mouse Description:
enhancer trap locus 4 Gene [Source:MGI Symbol;Acc:MGI:95454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17408 Nonsense Available for shipment Available now
sa15875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056750 Nonsense 1279 1841 20 25
ENSDART00000131376   None 825 None 12
ENSDART00000139247   None 97 None 3

The following transcripts of ENSDARG00000031658 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29605087)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29906722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTWCATACACACTTGYCTGTCTCACAAGCCTCAGCTGCTCCTGATAAGT[C/G]AAAGCATAAACATCGGGCAACCACTGTTCAAGTTACGCTTGTCAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056750 Nonsense 1647 1841 21 25
ENSDART00000131376   None 825 None 12
ENSDART00000139247   None 97 None 3

The following transcripts of ENSDARG00000031658 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29606268)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29907903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACCAGARGAAGCCAGTCCCACAAAGAGGCCTGCACCTCTGAAGCCC[A/T]AACCTAGCAAGTCATCGCTGCAAAAAAGATCTAAAACACAGTCTCGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link