pan3

Ensembl ID:
ENSDARG00000031637
ZFIN ID:
ZDB-GENE-070928-13
Description:
Zgc:171628 protein [Source:UniProtKB/TrEMBL;Acc:A7MBT0]
Human Orthologue:
PAN3
Human Description:
PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29991]
Mouse Orthologue:
Pan3
Mouse Description:
PAN3 polyA specific ribonuclease subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15531 Nonsense Available for shipment Available now
sa5993 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048273 Nonsense 316 799 6 18
ENSDART00000147250   None 213 None 4

The following transcripts of ENSDARG00000031637 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22337285)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21584163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCGGAGCCCACATAATTCAAAAGGAGACTGTAGGCGGAACAACCTA[C/A]TTCTATACYGATAACACCCCTGCTCCATTGGCTGGRATGGYATGTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048273 Essential Splice Site 329 799 6 18
ENSDART00000147250   None 213 None 4

The following transcripts of ENSDARG00000031637 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22337326)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21584204
KASP Assay ID:
554-3744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACCTACTTCTATACYGATAACACCCCTGCTCCATTGGCTGGRATGG[T/C]ATGTTCCATGTTAGTCAGAGTTTACTCTGTTAWTGTTWGTACATGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link