ENSDARG00000031624

Ensembl ID:
ENSDARG00000031624
Mouse Orthologues:
AC135640.1, AC165356.1
Mouse Descriptions:
predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]
predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30827 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047077 Nonsense 57 359 2 3
Genomic Location (Zv9):
Chromosome 3 (position 4490034)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4274268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCAGATGAAATGAGATCAAACTGTGAATCACTGAATGGAAACAGAT[C/A]AAATCTGGAGAAACACATCCTGAAGACACTGGCAGAAGAGGAGGACTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link