nrp2a

Ensembl ID:
ENSDARG00000031622
ZFIN ID:
ZDB-GENE-040611-2
Description:
neuropilin 2a [Source:RefSeq peptide;Acc:NP_998130]
Human Orthologue:
NRP2
Human Description:
neuropilin 2 [Source:HGNC Symbol;Acc:8005]
Mouse Orthologue:
Nrp2
Mouse Description:
neuropilin 2 Gene [Source:MGI Symbol;Acc:MGI:1100492]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30798 Nonsense Mutation detected in F1 DNA During 2017
sa13721 Nonsense Available for shipment Available now
sa25512 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13255 Essential Splice Site Available for shipment Available now
sa32581 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103769 Nonsense 2 787 1 14
ENSDART00000125437   None 165 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4565759)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4983481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTCTGTCATTGTTATCTTAATCCGTGTTTCTCCTTTGTGTCTGTTTG[T/A]TCTGCAGGAGCTGAGCATTGTTTCCGTAATTTCAGTTCCCCAACCGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103769 Nonsense 210 787 4 14
ENSDART00000125437   None 165 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4556240)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4973962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTTCCTCAAGGTTCTGACCGGCATCGCTACTCAAGGAGCCATTTCC[A/T]AAGAGACCCAGAAGTCATACTACGTCACMACCTTCAAGCTGGAAGTYAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103769 Essential Splice Site 407 787 6 14
ENSDART00000125437   None 165 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4537357)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4955079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGGAAAGACTGGAACTTTGTAATAGATAGCAAGACTAGCATGCCTAAG[G/A]TATAACATCTGTCCAATGCATACTCTTAAAGTGTCCCTATAATGCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103769 Essential Splice Site 456 787 7 14
ENSDART00000125437   None 165 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4535660)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4953382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCAGGCATCGGAATGAGAATGGAAGTATTGGGCTGCAACCTGCCAGG[T/C]AAGACACAGTCCTCAGGTACWTCGCTGTTGTCARATCATAAGCAGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103769 Nonsense 767 787 14 14
ENSDART00000125437   None 165 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4497153)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4910604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGGCTTAACGTCTCGCTCTTCCACCACTTTGGAGAACTACAACTTC[G/T]AGCTATACGATGGGATTAAGCACAAAGTGAAGCTCAACCAACAGCGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link